xbai sites (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
xbai sites
Xbai Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6921 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xbai+site/XbaI/pm42844471-698-19-25
Average 99 stars, based on 6921 article reviews
Xbai Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6921 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/xbai+site/XbaI/pm42844471-698-19-25
Average 99 stars, based on 6921 article reviews
xbai sites - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: ARF degradation defines a deeply conserved step in auxin response Article Snippet: .. Next, the plasmid pMpGWB100, carrying a hygromycin resistance casette, was digested with the restriction enzyme XbaI (Thermo Fisher Scientific), and the aforementioned MpARF2 promoter was ligated downstream of an Article Title: Zebrafish Polymerase Theta and human Polymerase Theta: Orthologues with homologous function. Article Snippet: .. First, the polymerase domain of zebrafish Pol θ (residues 1832–2576) was amplified from the cDNA library with primers containing a 5’ KpnI site and a 3’ BamHI site: Pol θ RVS BamHI- TATACTGGATCCTTATATGTCCAGGTCTTGAAGGTTACC Pol θ FWD KpnI- ATTAGGTACCTCAACATCAGTGTTAGGCGCAC PLOS One | https://doi.org/10.1371/journal.pone.0321886 April 29, 2025 14 / 21 Second, the 6xHIS and SUMO sequences (HIS-SUMO) of POLQM1 were amplified off of the plasmid using primers containing a 5’ Article Title: ARF degradation defines a deeply conserved step in auxin response. Article Snippet: .. Next, the plasmid pMpGWB100, carrying a hygromycin resistance casette, was digested with the restriction enzyme XbaI (Thermo Fisher Scientific), and the aforementioned MpARF2 promoter was ligated downstream of an Article Title: Zebrafish Polymerase Theta and human Polymerase Theta: Orthologues with homologous function Article Snippet: .. First, the polymerase domain of zebrafish Pol θ (residues 1832–2576) was amplified from the cDNA library with primers containing a 5’ KpnI site and a 3’ BamHI site: Second, the 6xHIS and SUMO sequences (HIS-SUMO) of POLQM1 were amplified off of the plasmid using primers containing a 5’ Sequencing:Article Title: ARF degradation defines a deeply conserved step in auxin response Article Snippet: .. Next, the plasmid pMpGWB100, carrying a hygromycin resistance casette, was digested with the restriction enzyme XbaI (Thermo Fisher Scientific), and the aforementioned MpARF2 promoter was ligated downstream of an Article Title: ARF degradation defines a deeply conserved step in auxin response. Article Snippet: .. Next, the plasmid pMpGWB100, carrying a hygromycin resistance casette, was digested with the restriction enzyme XbaI (Thermo Fisher Scientific), and the aforementioned MpARF2 promoter was ligated downstream of an Amplification:Article Title: Zebrafish Polymerase Theta and human Polymerase Theta: Orthologues with homologous function. Article Snippet: .. First, the polymerase domain of zebrafish Pol θ (residues 1832–2576) was amplified from the cDNA library with primers containing a 5’ KpnI site and a 3’ BamHI site: Pol θ RVS BamHI- TATACTGGATCCTTATATGTCCAGGTCTTGAAGGTTACC Pol θ FWD KpnI- ATTAGGTACCTCAACATCAGTGTTAGGCGCAC PLOS One | https://doi.org/10.1371/journal.pone.0321886 April 29, 2025 14 / 21 Second, the 6xHIS and SUMO sequences (HIS-SUMO) of POLQM1 were amplified off of the plasmid using primers containing a 5’ Article Title: Zebrafish Polymerase Theta and human Polymerase Theta: Orthologues with homologous function Article Snippet: .. First, the polymerase domain of zebrafish Pol θ (residues 1832–2576) was amplified from the cDNA library with primers containing a 5’ KpnI site and a 3’ BamHI site: Second, the 6xHIS and SUMO sequences (HIS-SUMO) of POLQM1 were amplified off of the plasmid using primers containing a 5’ cDNA Library Assay:Article Title: Zebrafish Polymerase Theta and human Polymerase Theta: Orthologues with homologous function. Article Snippet: .. First, the polymerase domain of zebrafish Pol θ (residues 1832–2576) was amplified from the cDNA library with primers containing a 5’ KpnI site and a 3’ BamHI site: Pol θ RVS BamHI- TATACTGGATCCTTATATGTCCAGGTCTTGAAGGTTACC Pol θ FWD KpnI- ATTAGGTACCTCAACATCAGTGTTAGGCGCAC PLOS One | https://doi.org/10.1371/journal.pone.0321886 April 29, 2025 14 / 21 Second, the 6xHIS and SUMO sequences (HIS-SUMO) of POLQM1 were amplified off of the plasmid using primers containing a 5’ Article Title: Zebrafish Polymerase Theta and human Polymerase Theta: Orthologues with homologous function Article Snippet: .. First, the polymerase domain of zebrafish Pol θ (residues 1832–2576) was amplified from the cDNA library with primers containing a 5’ KpnI site and a 3’ BamHI site: Second, the 6xHIS and SUMO sequences (HIS-SUMO) of POLQM1 were amplified off of the plasmid using primers containing a 5’ Transformation Assay:Article Title: Supporting Information for FlaG competes with FliS-flagellin complexes for access to FlhA in the flagellar T3SS to control Campylobacter jejuni filament length Article Snippet: .. This fragment was inserted into the Ligation:Article Title: Chromatin modification abnormalities by CHD7 and KMT2C loss promote medulloblastoma progression. Article Snippet: .. Subsequently, the U6-sgGOI cassette was inserted into the Clone Assay:Article Title: Method of producing a tripeptide gamma-glu-val-gly using enterobacteriaceae Article Snippet: .. The gshB fragment was cloned at Cloning:Article Title: Method of producing a tripeptide gamma-glu-val-gly using enterobacteriaceae Article Snippet: .. The gshB fragment was cloned at Electroporation:Article Title: Supporting Information for FlaG competes with FliS-flagellin complexes for access to FlhA in the flagellar T3SS to control Campylobacter jejuni filament length Article Snippet: .. These fragments were joined together and inserted into the |